Journal: Stem cells (Dayton, Ohio)

Article Title: Cnot1, Cnot2, and Cnot3 Maintain Mouse and Human ESC Identity and Inhibit Extraembryonic Differentiation

doi: 10.1002/stem.1070

Figure Lengend Snippet: The Cnot genes maintain self-renewal by repressing early trophectoderm (TE) transcription factors. (A): Cnot1, Cnot2, and Cnot3 knockdown did not immediately affect known self-renewal factors and pathways. Oct4GiP cells were transfected with control-siRNA (Control), Cnot1-siRNA1 (Cnot1-KD), Cnot2-siRNA2 (Cnot2-KD), or Cnot3-siRNA2 (Cnot3-KD) in M15 medium. Cells were collected 48 hours after transfection, and total Stat3, Smad1, b-Catenin as well as phospho-Stat3, phospho-Smad1, phosphor-b-Catenin, Oct4, and Nanog levels were determined by Western blot. Starved: control-transfected ESCs cultured in serum-free and LIF-free medium for additional 4 hours. (B): Comparing gene expression changes caused by perturbations of known self-renewal factors: Cnot1, 2, and 3 silencing induced similar changes to those of Oct4 or Sox2 silencing. Pearson's correlation coefficients were calculated between microarray datasets and depicted in a heatmap. The self-renewal factors were clustered by unsupervised hierarchical clustering based on the correlation coefficients. Microarray datasets used for this plot are listed in Supporting Information Table 2. (C): Cnot2 or Cnot3 overexpression cannot rescue Oct4 or Sox2 silencing-induced differentiation. Oct4GiP cells and Oct4GiP cells overexpressing Cnot2 (Cnot2-Rescue, same as in Fig. 1C) or Cnot3 (Cnot3-Rescue, same as in Fig. 1C) were transfected with control, Oct4 (Oct4-KD), or Sox2 (Sox2-KD) siRNAs, and the % differentiation was determined by the Oct4GiP reporter assay. (D): Cnot1, Cnot2, and Cnot3 knockdown induced TE differentiation in the presence of sustained Oct4 expression. ZHBTc4 cells that constitu-tively express Oct4 at the normal level from a Tet-Off promoter were transfected with control or Cnot1-siRNA1 (Cnot1-KD), Cnot2-siRNA2 (Cnot2-KD), Cnot3-siRNA2 (Cnot3-KD), and the expression of TE markers Cdx2 and Gata3 was determined by qRT-PCR after 4 days. (E): Cdx2 deletion partially rescued Cnot1, Cnot2, and Cnot3 silencing-induced differentiation. Oct4GiP (WT) or dKO23-5 (Cdx2-/- ) cells were transfected with Control-siRNA (Control), Cnot1-siRNA1 (Cnot1-KD), Cnot2-siRNA2 (Cnot2-KD), or Cnot3-siRNA2 (Cnot3-KD), and the expression of lineage markers was determined by qRT-PCR 96-hour after transfection. Abbreviations: ESC, embryonic stem cell; KD, Knockdown; WT, wild type.

Article Snippet: Human ESC Culture and siRNA Transfection Human ESC line H1 (WA01) and H9 (WA09) were received from WiCell Research Institute.

Techniques: Transfection, Western Blot, Cell Culture, Expressing, Microarray, Over Expression, Reporter Assay, Quantitative RT-PCR

Journal: Stem cells (Dayton, Ohio)

Article Title: Cnot1, Cnot2, and Cnot3 Maintain Mouse and Human ESC Identity and Inhibit Extraembryonic Differentiation

doi: 10.1002/stem.1070

Figure Lengend Snippet: Silencing Cnot1, Cnot2, or Cnot3 led to mouse embryonic stem cell (ESC) differentiation. (A): Silencing Cnot1, Cnot2, or Cnot3 resulted in ESC differentiation based on the Oct4GiP reporter assay. Oct4GiP ESCs were transfected with indicated siRNAs (two different siR NAs for each CCr4-Not complex gene) in M15 medium and cultured for 4 days. The percentage of differentiated cells (% differentiation) was determined by measuring the percentage of green fluorescent protein-negative cells by fluorescence-activated cell sorting (FACS) at the end of the culture. (B): Expression of siRNA-resistant Cnot2 or Cnot3 rescued the differentiation caused by Cnot2 or Cnot3 knockdown, respectively. Oct4GiP cells or Oct4GiP cells expressing siRNA-resistant Cnot2 (Cnot2-Rescue) or Cnot3 (Cnot3-Rescue) were transfected with Control, Cnot1-siRNA1, Cnot2-siRNA2, or Cnot3-siRNA2, and the percentage of differentiated cells was determined by the Oct4GiP reporter assays. Note that Cnot2-Rescue cells were not able to rescue the differentiation caused by Cnot1 or Cnot3 silencing, and Cnot3-Rescue cells were not able to rescue Cnot1 or Cnot2 silencing. ***, p < .001. (C): Silencing Cnot1, Cnot2, or Cnot3 resulted in morphological changes and loss of alkaline phosphatase (AP) staining in ESCs. Oct4GiP cells were transfected with the indicated siRNAs and cultured in the M15 medium. Cells were stained with the AP staining kit and imaged 4 days after transfection. (D): Cnot1, Cnot2, or Cnot3 silencing led to downregulation of ESC marker and upregulation of differentiation markers. Oct4GiP cells were transfected with the indicated siRNAs and cultured in the M15 medium. Cells were harvested for quantitative real-time PCR (qRT-PCR) analysis 4 days after transfection. ESC marker: Oct4; differentiation markers: Cdx2, Eomes, Gata3, Hand1, and Krt8. (E): Cnot1, Cnot2, or Cnot3 silencing reduced cell proliferation or viability in 2i medium. Oct4GiP cells were transfected with control-siRNA (Control), Cnot1-siRNA1 (Cnot1-KD), Cnot2-siRNA2 (Cnot2-KD), or Cnot3-siRNA2 (Cnot3-KD) and cul tured in 2i medium. Cell numbers were counted by FACS 4 days after transfection and normalized to control-transfected cells. (F): Cnot1, Cnot2, or Cnot3 silencing led to differentiation in 2i medium. Oct4GiP cells were transfected with indicated siRNAs and cultured in 2i medium. Cells were harvested for qRT-PCR analysis 4 days after transfection. (G): Expression of C-terminally HA-tagged Cnot2 (Cnot2-HA) in E14Tg2a cells. Expression of the exogenous Cnot2-HA was detected in Western blot with the HA-antibody, and Ran was used as a loading control. Expression of total (endogenous and exogenous) Cnot2 was determined by qPCR in wild-type E14Tg2a (E14) and Cnot2-HA expressing cells. The expression of the Cnot2-HA was estimated to be ∼2-fold of the endogenous Cnot2 on the mRNA level. (H): Identification of Cnot1 and Cnot3 in Cnot2-HA immunoprecipitation. HA-pull-down was carried out in E14Tg2a cells expressing Cnot2-HA. The presence of Cnot1, Cnot2-HA, and Cnot3 in the total lysate and pull-down sample (HA-beads) were detected by Western blot. Note that Oct4 was not detected in the pull down sample. As a negative control, protein-A beads were used in an independent pull-down. Abbreviations: HA, hemagglutinin; IP, immunoprecipitation; KD, knockdown.

Article Snippet: Human ESC Culture and siRNA Transfection Human ESC line H1 (WA01) and H9 (WA09) were received from WiCell Research Institute.

Techniques: Reporter Assay, Transfection, Cell Culture, Fluorescence, FACS, Expressing, Staining, Marker, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot, Immunoprecipitation, Negative Control

Journal: Stem cells (Dayton, Ohio)

Article Title: Cnot1, Cnot2, and Cnot3 Maintain Mouse and Human ESC Identity and Inhibit Extraembryonic Differentiation

doi: 10.1002/stem.1070

Figure Lengend Snippet: Cnot1, Cnot2, and Cnot3 are required for human embryonic stem cell (ESC) self-renewal. (A): Cnot1, Cnot2, and Cnot3 were down-regulated during human ESC differentiation. H1 human ESCs were differentiated for 7 days using 100 ng/ml human recombinant BMP4. The expression levels of Cnot1, Cnot2, and Cnot3 as well as Oct4 and differentiation markers Cdx2 and Hand1 were determined by quantitative realtime PCR (qRT-PCR). (B): Silencing of Cnot1, Cnot2, or Cnot3 led to morphological changes of human ESCs. H1 cells were imaged 6 days after transfection. Phase-contrast images highlight the undifferentiated morphology of human ESCs in the lipids-only transfected cells (mock) versus the differentiated phenotype in the Cnot1, Cnot2, or Cnot3 siRNA transfected cells. (C): Silencing of the Cnot genes led to upregulation of the Cdx2 and Gata3 proteins. H1 cells were transfected with lipids-only (mock), Oct4, Cnot2, or Cnot3 siRNAs. Cells were fixed and stained for Cdx2 or Gata3 expression by immunofluorescence staining 6 days after transfection. (D): Silencing of the Cnot genes led to downregulation of the ESC marker and upregulation of the extraembryonic markers. H1 cells were harvested 6 days after transfection and marker expression was determined by qRT-PCR. Abbreviations: BMP, bone morphogenetic protein; DAPI, 4′-6-diamidino-2-phenylindole.

Article Snippet: Human ESC Culture and siRNA Transfection Human ESC line H1 (WA01) and H9 (WA09) were received from WiCell Research Institute.

Techniques: Recombinant, Expressing, Quantitative RT-PCR, Transfection, Staining, Immunofluorescence, Marker

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: Targeting CRABP-II overcomes pancreatic cancer drug resistance by reversing lipid raft cholesterol accumulation and AKT survival signaling

doi: 10.1186/s13046-022-02261-0

Figure Lengend Snippet: CRABP-II regulates cholesterol metabolic genes expression through cooperation with HuR. ( A ) Molecular and cellular function analysis by IPA software (Qiagen) based on gene expression microarray profiling. The altered lipid synthesis and accumulation functions upon CRABP-II knockout were listed. ( B ) Heat map of altered cholesterol metabolic genes. ( C, D, E ) Cholesterol metabolic genes expression assessed by Q-PCR. ( F ) Correlation between cholesterol metabolic genes and CRABP-II expression in human pancreatic cancer specimens by Pearson’s product-moment correlation coefficient analysis (PPMCC). Data shown here are combination of Pei Pancreas and Badea Pancrease datasets ( n = 75) from Oncomine. ( G ) Interaction between CRABP-II and HuR identified by co-immuprecipitation (co-IP). GR4000 cell lysis was incubated with anti-CRABP-II rabbit polyclonal antibody and the pull down proteins were separated and blotted with anti-HuR mouse monoclonal antibody. ( H ) Half-life of SREBP-1c mRNA assessed by actinomycin D treatment following with Q-PCR. ( I ) RNA-immunoprecipitation (RIP). The down pulled SREBP-1c mRNA from flagged-CRABP-II transfected CIIKO cells and empty vector transfected cells were assessed by Q-PCR. The actin mRNA was used as control. The experiment was repeated three times and the error bars present standard deviation (SD). **, p < 0.01

Article Snippet: Antibodies used in this study include: CRABP-II mouse mAbs (Millipore, MAB5488), CRABP-II rabbit polyclonal antibody (Proteintech, 10,225–1-AP), HuR (3A2, Santa Cruz, sc-5261), Flotilin-2 (Santa Cruz, sc-28320), GAPDH (Santa Cruz, sc-365062), and Actin (Santa Cruz, sc-1615), anti-Flag M2 mAb (Sigma, F9291), anti-Flag agarose beads (Clontech, #635,686), Ki67 (SP6, ThermoFisher, RM-9106-S0), ADRP (Novus, NB110-40,877), Caspas3 (Cell Signaling, #9662), PARP (Cell Signaling, #9542), AKT (Cell Signaling, #4691), mTOR (Cell Signaling, #2983), S6 (Cell Signaling, #2217), pAKT (S473, Cell Signaling, #9018), pmTOR (Cell Signaling, #5536), pS6 (Cell Signaling, #4858), and pGSK3β (Cell Signaling, #5558).

Techniques: Expressing, Cell Function Assay, Software, Gene Expression, Microarray, Knock-Out, Co-Immunoprecipitation Assay, Lysis, Incubation, RNA Immunoprecipitation, Transfection, Plasmid Preparation, Control, Standard Deviation

Journal: BioMed Research International

Article Title: MicroRNAs as Salivary Markers for Periodontal Diseases: A New Diagnostic Approach?

doi: 10.1155/2016/1027525

Figure Lengend Snippet: Comparison of methods from current investigations regarding miRNAs in periodontal disease.

Article Snippet: Naqvi et al. 2014 [ ] , Human THP-1-differentiated macrophages , miRNeasy kit (Qiagen) , NanoString nCounter miRNA assay (NanoString Technologies) , Quantitative real-time PCR EvaGreen Master Mix (Biotium) , — , RNU6B , Student's t -test (two-tailed) , miR-29b miR-32 miR-146a miR-891.

Techniques: Comparison, RNA Extraction, Biomarker Discovery, Control, In Vitro, Microarray, Isolation, TaqMan microRNA Assay, SYBR Green Assay, Labeling, Real-time Polymerase Chain Reaction, Virus, Quantitative RT-PCR, In Vivo, Expressing, Mann-Whitney U-Test

Journal: Nature cell biology

Article Title: Medial HOXA genes demarcate haematopoietic stem cell fate during human development

doi: 10.1038/ncb3354

Figure Lengend Snippet: (A, B) Microarray analysis of HOXA gene expression in CD34 + CD38 −/lo CD90 + GPI-80 + cells and their progeny (Mean values are shown, left, n=3 samples, GEO database GSE54316, and right, n=3 samples (CD34+CD38-CD90+) or 2 (CD34+CD38-CD90- and CD34+CD38-) GSE34974. (C) Schematic showing the strategy for lentiviral shRNA knockdown of HOXA5 or HOXA7 in FL-HSPCs. (D) Knockdown is confirmed using q-RT-PCR 1 week post-infection (mean +/- SD shown from n=3 different FL samples). (E) Representative FACS plots 30 days after HOXA5 or HOXA7 knockdown. (F) Quantification of HSPC subsets in empty-vector (CTR) and shRNA infected cells (shHOXA5 or shHOXA7) after 5, 14 and 30 days in culture (mean and SEM, n=6 independent experiments per condition for day 14 and n=3 for day 5 and 30). Statistical significance was assessed using Wilcoxon Signed Rank test. (G) Schematic showing the transplantation strategy with HOXA5 or HOXA7 knockdown FL-HSPCs. (H) Representative FACS plots from mouse BM 10 weeks post-transplantation assessing human CD45 + cells and multi-lineage engraftment (CD19 and CD3 for B-and T-lymphoid, and CD66 and CD33 for myeloid). (I) Quantification of human engraftment (n=9 mice per condition from 3 independent experiments Individual values and mean are shown.) Statistical significance was assessed using the Wilcoxon Rank Sum test (J) RNA-sequencing of HOXA7 knockdown FL-HSPCs at day 5 post-infection. Number of genes up- or down-regulated in sh HOXA7 FL-HSPCs are shown. Genes dysregulated both in HOXA7 knockdown FL-HSPCs (RNA-seq 1.8-fold change, n=4 independent experiments, p-value < 0.05) and in EB-OP9-HSPCs compared to FL-HSPCs (microarray, 2-fold change, p-value < 0.05) are shown in blue pattern overlay. (K) Examples of HSC factors downregulated in HOXA7 knockdown FL-HSPCs and (L) differentiation associated genes upregulated in HOXA7 knockdown FL-HSPCs. Mean shown for n=4 independent specimens, values used to generate graphs can be found in and GEO database GSE76685). See for Statistics source data for 4D, F and I.

Article Snippet: Human HOXA5, HOXA7 and HOXA9 were cloned from human FL full-length cDNA, into either the constitutive pFUGW lentiviral vector, (Addgene plasmid # 14883, from David Baltimore), downstream and in frame with the GFP sequence with the synthetic addition a P2A sequence between the 2 ORFs, or the inducible lentiviral overexpression system pNL-EGFP/TREPittdU3, (Addgene plasmid # 18659, from Jakob Reiser), between the sites BamHI and NheI. pNL-TREpitt vectors were co-transduced with the constitutive pNL-EF1α-rTTA-M2 lentiviral vector to provide in trans the Tet transactivator.

Techniques: Microarray, Expressing, shRNA, Reverse Transcription Polymerase Chain Reaction, Infection, Plasmid Preparation, Transplantation Assay, RNA Sequencing Assay

Journal: Nature cell biology

Article Title: Medial HOXA genes demarcate haematopoietic stem cell fate during human development

doi: 10.1038/ncb3354

Figure Lengend Snippet: (A) Schematic showing the strategy for constitutive lentiviral overexpression of HOXA5 or HOXA7 in FUGW vectors in FL-HSPCs. (B) Representative FACS plots of FUGW empty vector, HOXA5- or HOXA7- overexpressing FL-HSPCs. (C, D) Expansion of total FL cells (C) or HSPCs (D) transduced with HOXA5- or HOXA7- overexpression vectors or empty vector control (CTR), (mean and SEM values from n=3 independent experiments; statistical significance was assessed using the paired Student’s t -test. (E) q-RT-PCR confirming overexpression in transduced HSPCs sorted 1 week post-infection (n=1 experiment with 2 pooled donors). (F) CFU-Cs from 2000 HSPCs sorted after day 10 of infection with vectors overexpressing HOXA5 or HOXA7 or FUGW empty vector control (mean and SD values shown from n=4 transductions from 2 independent experiments, p-values shown correspond to CTR vs. OE-HOXA7). (G) Schematic showing the strategy for lentiviral overexpression of HOXA5 and/or HOXA7 and/or HOXA9 in FUGW vectors in EB CD34 + cells. (H) Representative examples of FACS plots of EB CD34 + cells overexpressing HOXA5 or HOXA7 or a combination of HOXA5 , HOXA7 and HOXA9 . Un-transduced FL is shown as a control. (I) Quantification of CD34 + CD38 −/lo CD45 + haematopoietic cells from (H), mean from n=4 independent experiments for CTR and n=3 for HOXA5/7/9, HOXA5, and HOXA7 at days 0 and 24, and n=2 at all other time points. J) Representative FACS plots and (K) quantification of human CD45 + cells in the BM of NSG mice 12 weeks post-transplantation. Multi-lineage engraftment is assessed by CD19 and CD3 (B-and T-lymphoid) and CD66 and CD33 (myeloid) (mean from n=5 mice per condition (except for FL n=4) from two independent experiments). (L). Q-RT-PCR for HOXA7 from transduced EB-OP9-HSPCs 2 weeks post-infection from one representative experiment. (M) Graphs representing RNA-seq of EB-OP9 cells overexpressing HOXA7 for genes regulated by HOXA7 in FL-HSPCs (one representative experiment, GEO database GSE76685). See for statistics source data in D, E, F, I and K.

Article Snippet: Human HOXA5, HOXA7 and HOXA9 were cloned from human FL full-length cDNA, into either the constitutive pFUGW lentiviral vector, (Addgene plasmid # 14883, from David Baltimore), downstream and in frame with the GFP sequence with the synthetic addition a P2A sequence between the 2 ORFs, or the inducible lentiviral overexpression system pNL-EGFP/TREPittdU3, (Addgene plasmid # 18659, from Jakob Reiser), between the sites BamHI and NheI. pNL-TREpitt vectors were co-transduced with the constitutive pNL-EF1α-rTTA-M2 lentiviral vector to provide in trans the Tet transactivator.

Techniques: Over Expression, Plasmid Preparation, Transduction, Reverse Transcription Polymerase Chain Reaction, Infection, Transplantation Assay, RNA Sequencing Assay

Journal: The Journal of Biological Chemistry

Article Title: TGF-β/SMAD3 Pathway Stimulates Sphingosine-1 Phosphate Receptor 3 Expression

doi: 10.1074/jbc.M116.740084

Figure Lengend Snippet: Up-regulation of S1PR3 in human lung adenocarcinomas. A, qPCR quantitation of S1PR3 mRNA in cDNA arrays of human lung adenocarcinoma specimens (OriGene, HLRT101 and HLRT105). **, p < 0.01, Student's t test. B, qPCR quantitation of S1PR2 mRNA in a cDNA array of human lung cancers (OriGene, HLRT105). **, p < 0.01, Student's t test. C, HEK293 cells were transfected with S1PR3 or pcDNA vector. Transfected cells were immunostained with anti-S1PR3 (Cayman Chemical) (IMF, left panels). Arrows, nonspecific fluorescent precipitates used for image orientation. Scale bar = 33 μm. D, anti-S1PR3 staining of human lung adenocarcinoma tumor microarray (Accumax 306). AdC, adenocarcinoma; N, adjacent normal lung tissue. E, immunostaining intensity was quantitated with the National Institutes of Health ImageJ software. Data, analyzed with GraphPad Prism 5 software, are shown as mean ± S.E. Statistical significance was analyzed by Student's t test. F, representative images of anti-S1PR3 staining of human lung adenocarcinoma and the respective adjacent normal lung epithelial tissue. G, quantitation of anti-S1PR3 staining of human lung squamous carcinoma microarray (Accumax 306). Data are mean ± S.E. Statistical significance was analyzed by Student's t test. H, representative images of anti-S1PR3 staining of human lung squamous carcinoma and the respective adjacent normal lung epithelial tissue.

Article Snippet: A , qPCR quantitation of S1PR3 mRNA in cDNA arrays of human lung adenocarcinoma specimens (OriGene, HLRT101 and HLRT105).

Techniques: Quantitation Assay, Transfection, Plasmid Preparation, Staining, Microarray, Immunostaining, Software

Journal: The Journal of Biological Chemistry

Article Title: TGF-β/SMAD3 Pathway Stimulates Sphingosine-1 Phosphate Receptor 3 Expression

doi: 10.1074/jbc.M116.740084

Figure Lengend Snippet: Oncogenic K-Ras mutant stimulates S1PR3 expression. A, LSL-K-RasG12D mice were intratracheally injected with empty adenoviral (Ad-Ctrl) or Ad-Cre particles (1 × 108 pfu). The development of lung adenocarcinomas (arrows) was analyzed 2 months later. Scale bar = 0.5 cm. B, K-RasG12D mice were injected with Ad-Ctrl or Ad-Cre particles. 2 months later, levels of S1PRs in lungs were measured by qPCR analysis. ** and *, p < 0.01 and 0.05, respectively. NS, non-statistically significant. n = 5, Student's t test. C, immunohistochemical staining of S1PR3 in lung specimens from wild-type or K-Ras transgenic mice. Note that levels of S1PR3 are profoundly increased in lung adenocarcinoma of K-Ras transgenic mice (arrows). Scale bar = 200 μm.

Article Snippet: A , qPCR quantitation of S1PR3 mRNA in cDNA arrays of human lung adenocarcinoma specimens (OriGene, HLRT101 and HLRT105).

Techniques: Mutagenesis, Expressing, Injection, Immunohistochemical staining, Staining, Transgenic Assay

Journal: The Journal of Biological Chemistry

Article Title: TGF-β/SMAD3 Pathway Stimulates Sphingosine-1 Phosphate Receptor 3 Expression

doi: 10.1074/jbc.M116.740084

Figure Lengend Snippet: TGF-β/SMAD3 signaling contributes to oncogenic K-Ras mutant-stimulated S1PR3 up-regulation. A, P, potential SMAD3 binding sites in S1PR3 promoter. 0, transcription initiation site. B–D, HEK293 cells were stably transfected with pBabe-K-RasG12V or pBabe control vector. Levels of total cellular K-Ras (B), S1PRs (C), and TGF-β (D) were measured by qPCR analysis. E, HEK293 cells transfected with pBabe-K-RasG12V or pBabe control vector were incubated with anti-TGF-β (Cell Signaling, antibody number 3711, 10 μg/ml) or irrelevant normal rabbit IgG (10 μg/ml) at 37 °C for 24 h. Levels of S1PR3 were quantitated by qPCR. F, HEK293 cells transfected with pBabe-K-RasG12V or pBabe control vector were treated with or without SB-431542 (SB4) (inhibitor of TGF-β receptor I, 10 μm) or SIS3 (inhibitor of SMAD3, 2 μm) at 37 °C for 24 h. Levels of S1PR3 were quantitated by qPCR. **, p < 0.01, n = 3, Student's t test.

Article Snippet: A , qPCR quantitation of S1PR3 mRNA in cDNA arrays of human lung adenocarcinoma specimens (OriGene, HLRT101 and HLRT105).

Techniques: Mutagenesis, Binding Assay, Stable Transfection, Transfection, Plasmid Preparation, Incubation

Journal: The Journal of Biological Chemistry

Article Title: TGF-β/SMAD3 Pathway Stimulates Sphingosine-1 Phosphate Receptor 3 Expression

doi: 10.1074/jbc.M116.740084

Figure Lengend Snippet: Candidate SMAD3 binding elements (SBEs) on the promoter region of S1PR3 gene

Article Snippet: A , qPCR quantitation of S1PR3 mRNA in cDNA arrays of human lung adenocarcinoma specimens (OriGene, HLRT101 and HLRT105).

Techniques: Binding Assay, Sequencing

Journal: The Journal of Biological Chemistry

Article Title: TGF-β/SMAD3 Pathway Stimulates Sphingosine-1 Phosphate Receptor 3 Expression

doi: 10.1074/jbc.M116.740084

Figure Lengend Snippet: TGF-β/SMAD3 signaling axis up-regulates S1PR3. A, HBEC2-KT cells were treated with TGF-β (1 ng/ml) for various times. mRNA levels of S1P receptors were measured by qPCR analysis. Data are mean ± S.D. of triplicate determinations. *, p < 0.05, Student's t test. B, protein levels of S1PR3 in TGF-β (1 ng/ml)-treated HBEC2-KT cells. Lower panel, Western blot intensity was quantitated by National Institutes of Health ImageJ. Data (normalized to actin) are mean ± S.D. of triplicate determinations. * and **, p < 0.05 and 0.01, respectively, Student's t test. C, CHO cells were transduced with adenoviral particles (multiplicity of infection of 200) carrying S1PR1, S1PR2, or S1PR3 vector for 20 h as we described (8). Extracts were blotted with antibody against S1PR3 (Cayman), S1PR2 (Cayman), or S1PR1 (E49) (8). D, mRNAs of S1PR3 and TGF-β in minced C57BL/6 mouse lungs (∼1–2 mm3) infected with adenoviral active TGF-β (Ad-TGF-β, 1 × 108 pfu/ml) or empty vector (Ad-Ctrl) (37 °C, 24 h). **, p < 0.01, n = 5, Student's t test. E, mRNA levels of SphK1 and SphK2 in TGF-β-treated HBEC2-KT cells. F, HBEC2-KT cells (2 × 106 cells in 100-mm dish, 10 ml of cultural medium) were treated with TGF-β (1 ng/ml) for 24 h. Medium was quantitated for S1P, ceramide (Cer), and sphingomyelin (SPM) by LC-MS/MS (29, 46). G, HBEC2-KT were pretreated for 30 min with inhibitors. S1PR3 levels were measured by qPCR, following TGF-β treatment (4 h). The following inhibitors were used: SB4, TGF-β receptor I (SB-431542, 10 μm); SIS3, SMAD3 (2 μm); SB2, p38 kinase (SB-203580, 50 nm); BAY, NFκB (BAY11-7085, 10 μm); JII, JNK (JNK inhibitor II, 10 μm). *, p < 0.05; dashed line, non-statistical significance; n = 3, ANOVA. Each experiment was repeated 2–3 times with similar results. H, cells were pretreated for 30 min with inhibitors, followed by stimulation with TGF-β (1 ng/ml). Activation of p38, JNK, and NFκB was measured by Western blotting with phospho-p38 (P-p38), phospho-JNK (P-p54JNK and P-p46JNK), and phospho-IκBα (p-IκBα). Inhibitors used are: SB-203580 (50 nm) for p38 kinase, JNK inhibitor II (10 μm) for JNK, and BAY11-7085 (10 μm) for NFκB.

Article Snippet: A , qPCR quantitation of S1PR3 mRNA in cDNA arrays of human lung adenocarcinoma specimens (OriGene, HLRT101 and HLRT105).

Techniques: Western Blot, Transduction, Infection, Plasmid Preparation, Liquid Chromatography with Mass Spectroscopy, Activation Assay

Journal: The Journal of Biological Chemistry

Article Title: TGF-β/SMAD3 Pathway Stimulates Sphingosine-1 Phosphate Receptor 3 Expression

doi: 10.1074/jbc.M116.740084

Figure Lengend Snippet: SMAD3 transactivates S1PR3 promoter. A, immunostaining with anti-phospho-SMAD3 in HBEC2-KT treated with or without TGF-β (1 ng/ml, 15 min). Left, fluorescence; right, DAPI nuclear staining. Scale bar = 15.2 μm. B, ChIP was performed with anti-phopho-SMAD3 or normal IgG in HBEC2-KT treated with or without TGF-β (1 h). *, p < 0.05, TGF-β (+)/anti-phospho-SMAD3 versus TGF-β (−)/anti-phospho-SMAD3 (n = 3, Student's t test). C, HEK293 cells were co-transfected with pGL3 luciferase vector carrying double-stranded P13, P14, or P15 oligonucleotides, pcDNA-SMAD3 or empty pcDNA plasmids, and Renilla luciferase vector (5:5:1). 24 h later, both firefly and Renilla luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase activities were normalized to Renilla luciferase activities. D, HEK293 cells were co-transfected with pGL3 luciferase vector carrying P14 or scrambled P14 oligonucleotides, pcDNA-SMAD3 or empty pcDNA plasmids, and Renilla luciferase vector (5:5:1). 24 h later, luciferase activities (firefly/Renilla luciferase activity) were measured. **, p < 0.01; NS, non-statistical significance; n = 3, Student's t test.

Article Snippet: A , qPCR quantitation of S1PR3 mRNA in cDNA arrays of human lung adenocarcinoma specimens (OriGene, HLRT101 and HLRT105).

Techniques: Immunostaining, Fluorescence, Staining, Transfection, Luciferase, Plasmid Preparation, Reporter Assay, Activity Assay

Journal: The Journal of Biological Chemistry

Article Title: TGF-β/SMAD3 Pathway Stimulates Sphingosine-1 Phosphate Receptor 3 Expression

doi: 10.1074/jbc.M116.740084

Figure Lengend Snippet: S1PR3 regulates growth and lung colonization of lung adenocarcinoma cells. A, H1793 cells were stably transfected with sh-S1PR3 or pRS (sh-Ctrl) vector (11, 16). mRNA levels of S1PR3 were quantitated with qPCR analysis. B, H1793 cells (1 × 106 cells), stably transfected with sh-S1PR3 or sh-Ctrl vector, were subcutaneously inoculated in Scid mice. Tumor volume was measured in two dimensions using calipers, and volume was determined using the formula width2 × length × 0.52 (49). C, 4 weeks after inoculation, tumors were removed and weighed. D, Scid mice were injected with H1793 cells transfected with sh-S1PR3 or sh-Ctrl vector (1 × 106 cells) via tail vein route. 28 days later, tumor nodules on lung surface were scored. E, representative images of lung injected with H1793-sh-Ctrl and H1793-sh-S1PR3 cells. Arrows, tumor nodules. Scale bar = 0.5 cm. F, volume of xenograft tumors in athymic nude mice subcutaneously implanted with H1299 cells stably transfected with S1PR3 or control pcDNA vector (1 × 106 cells) (11, 16). G, qPCR quantitation of S1PR3 levels in H1299/pcDNA and H1299/S1PR3 cells. **, p < 0.01, n = 6, ANOVA.

Article Snippet: A , qPCR quantitation of S1PR3 mRNA in cDNA arrays of human lung adenocarcinoma specimens (OriGene, HLRT101 and HLRT105).

Techniques: Stable Transfection, Transfection, Plasmid Preparation, Injection, Quantitation Assay

Journal: The Journal of Biological Chemistry

Article Title: TGF-β/SMAD3 Pathway Stimulates Sphingosine-1 Phosphate Receptor 3 Expression

doi: 10.1074/jbc.M116.740084

Figure Lengend Snippet: Inhibition of S1PR3 diminishes lung carcinoma growth. A, C57BL/6 mice were subcutaneously inoculated with LLC cells (1 × 106 cells). 1 week later, mice were intraperitoneally administered with VPC23019 (1.5 mg/kg of body weight) or control vehicle every 3 days. B, S1PR1 and S1PR3 levels in Lewis lung carcinoma cells. −ve, PCR reactions were performed without cDNA. **, p < 0.01, n = 6, ANOVA. C, CHO cells were transduced with adenoviral particles carrying S1PR1, S1PR2, S1PR3, or pcDNA control vector. Cells were serum-starved for 24 h. Subsequently, cells were treated with TY-52156 (10 μm) for 10 min, followed by stimulating with S1P (200 nm, 10 min). ERK1/2 activation (p-ERK) was measured by Western blotting analysis. D, C57BL/6 mice were subcutaneously inoculated with LLC cells (1 × 106 cells). 1 week later, mice were intraperitoneally administered with TY-52156 (10 mg/kg of body weight) or control vehicle every 2 days. **, p < 0.01, n = 6, ANOVA. E, tumor weights were measured 24 days after implantation. **, p < 0.01, n = 6, ANOVA.

Article Snippet: A , qPCR quantitation of S1PR3 mRNA in cDNA arrays of human lung adenocarcinoma specimens (OriGene, HLRT101 and HLRT105).

Techniques: Inhibition, Transduction, Plasmid Preparation, Activation Assay, Western Blot

Journal: Journal of cellular biochemistry

Article Title: Expression of the ectodomain-releasing protease ADAM17 is directly regulated by the osteosarcoma and bone-related transcription factor RUNX2

doi: 10.1002/jcb.26832

Figure Lengend Snippet: To identify genes that immediately respond to osteogenic stimuli, we retrieved microarray data were retrieved for experiments with mouse C2C12 mesenchymal cells that were treated with 300 ng/ml of BMP-2 and analysed at distinct time points (0, 4, 8, 12, 16, 20, and 24 h). Data on ADAM genes were filtered for genes that show more than a 2 fold change in gene expresseion. This analysis revealed that the Adam17, Adam10 and Adam9 genes are upregulated for more than 2-fold (A), while three others are downregulated (Adam8, Adam15, Adam19) (B). (C) The bar graph shows average expression values (in RPKM; STD as error bar for n=3 human donors) that were rank ordered for relative expression based on RNA-seq analysis of human osteoblastic bone-derived cells from three different donors. The pie chart presented in the inset shows that the six most highly expressed ADAM genes (including the BMP-responsive ADAMs ADAM17, ADAM10 and ADAM9, which are presented in color) account for almost all (~97%) ADAM-related transcripts. (D) Results of RNA-seq analysis for each individual donor and select osteosarcoma cell lines (SaOS-2, MG63 and U2OS) as indicated. (E) Visual presentation and validation of gene expression data using semi-quantitative RT-PCR and ethidium bromide staining. ADAM17, ADAM10 and ADAM9 gene expression was assessed as indicated in human SAOS-2, MG63, U2OS, HOS, G292 and 143B immature osteoblast cells. The data shown are representative of three experiments with similar outcomes. The graphs show quantification of the RT-PCR data relative to Gapdh mRNA (D). All data are presented as mean ± SEM from three independent experiments.

Article Snippet: Mouse MC3T3–E1 osteoblasts, mouse pre-myogenic mesenchymal C2C12 precursor cells, rat osteosarcoma ROS17/2.8 cells and human osteosarcoma cell lines (SAOS-2, MG63, U2OS, G292, HOS and 143B cells) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA).

Techniques: Microarray, Expressing, RNA Sequencing, Derivative Assay, Biomarker Discovery, Gene Expression, Quantitative RT-PCR, Staining, Reverse Transcription Polymerase Chain Reaction

Journal: Journal of cellular biochemistry

Article Title: Expression of the ectodomain-releasing protease ADAM17 is directly regulated by the osteosarcoma and bone-related transcription factor RUNX2

doi: 10.1002/jcb.26832

Figure Lengend Snippet: Adam17 and Runx2 expression was assessed in mouse Runx2-null osteoprogenitor cells (Runx2−/−) and mouse MC3T3–E1 pre-osteoblasts cells, as well as rat ROS17/2.8 and human SAOS-2 osteosarcoma cells. Protein and mRNA levels were evaluated by western blot analysis (A, and down graph B) and RT-PCR (C, and down graph D), respectively. Runx2-null cells were infected with an adenovirus vector expressing RUNX2 or GFP (control) as indicated (E and G). Alternativelly, cells were transiently transfected with different concentrations (0.5, 1, 2.5, 5, and 10 μg of DNA) of pcDNA-Runx2 or pcDNA-empty vector (control) (I). Runx2-null cells expressing Adam17 and Runx2 mRNA (E, I, and down graph F and J) and protein levels (G, and down graph H) were evaluated by RT-PCR and western blot analysis, respectively. The data shown are representative of three experiments with similar outcomes. Adam17 and Runx2 mRNA and protein values were normalized to Gapdh and Actin, respectively. All data are presented as mean ± SEM from three independent experiments. *P<0.05 and **P<0.01.

Article Snippet: Mouse MC3T3–E1 osteoblasts, mouse pre-myogenic mesenchymal C2C12 precursor cells, rat osteosarcoma ROS17/2.8 cells and human osteosarcoma cell lines (SAOS-2, MG63, U2OS, G292, HOS and 143B cells) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA).

Techniques: Expressing, Western Blot, Reverse Transcription Polymerase Chain Reaction, Infection, Plasmid Preparation, Control, Transfection

Journal: Immunity

Article Title: The cytokine TNF promotes transcription factor SREBP activity and binding to inflammatory genes to activate macrophages and limit tissue repair

doi: 10.1016/j.immuni.2019.06.005

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: CD14 microbeads, human , Miltenyi Biotec , RRID:AB_2665482.

Techniques: Purification, Control, Virus, Plasmid Preparation, Recombinant, Amplex Red Cholesterol Assay, cDNA Synthesis, SYBR Green Assay, Multiplex Assay, RNA Library Preparation, Microarray, Software

Journal: Journal of Virology

Article Title: Rabies Virus Nucleoprotein Functions To Evade Activation of the RIG-I-Mediated Antiviral Response ▿

doi: 10.1128/JVI.02220-09

Figure Lengend Snippet: Schematic diagrams of genome organizations and replication efficiency of Ni, Ni-CE, and CE(NiN) strains. (A) Schematic diagrams of genome organizations of Ni, Ni-CE, and chimeric CE(NiN) strains. Shaded and open boxes represent open reading frames derived from Ni and Ni-CE strains, respectively. The pathogenicity of each strain for adult mice determined by our previous study (35) is also indicated. The pathogenicity was previously evaluated by i.c. inoculation with 1,000 FFU of each virus. ++, Lethal (all mice died within 7 days); +, lethal (all mice died within 10 days); -, nonlethal. (B) SYM-I cells were infected with Ni, Ni-CE, and CE(NiN) strains at an MOI of 2. Total cellular RNA was extracted at 6, 12, and 24 hpi and analyzed for viral genomic and antigenomic RNA levels by real-time PCR. Expression levels of genes were normalized to mRNA levels of GAPDH. Each point represents the mean (± the SD) of three independent replicates. ns, no significant difference.

Article Snippet: Sequences of the primers and a TaqMan probe are shown in Table . table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 Analysis Primer or probe Sequence (5′→3′) RT Rabies RT for genome CTGCTTGTAAACCAGGCATTCCCGGATGTCTG Rabies RT for anti-genome AAACAATCAAACAGCCAGAGGTCCAGATTC SYBR green assay Human GAPDH F CCTCCTGTTCGACAGTCAGC Human GAPDH R CGCCCAATACGACCAAATC TaqMan assay Rabies TaqMan probe TGATGTGTCTCGAAAA Rabies genome F GTCTGCACATGCTGAGACTCTTG Rabies genome R ACAGCCAGAGGTCCAGATTCA Open in a separate window Sequences of the primers and TaqMan probe For validation of microarray data, total RNA was reverse transcribed into cDNAs using SuperScript III reverse transcriptase and random hexamer (TaKaRa Bio).

Techniques: Derivative Assay, Infection, Real-time Polymerase Chain Reaction, Expressing

Journal: Journal of Virology

Article Title: Rabies Virus Nucleoprotein Functions To Evade Activation of the RIG-I-Mediated Antiviral Response ▿

doi: 10.1128/JVI.02220-09

Figure Lengend Snippet: Comparison of the gene expressions of SYM-I cells infected with Ni, Ni-CE, and CE(NiN) strains using a DNA microarray. SYM-I cells were infected with Ni, Ni-CE, and CE(NiN) strains at an MOI of 2. After 24 h, the total cellular RNA was extracted and used for DNA microarray analysis. The data were normalized by GeneSpring GX software. (A) Cluster analysis of genes of SYM-I cells infected with each virus. The expression pattern of genes involved in “host-pathogen interaction” is represented as a hierarchical clustering, using Cluster and Java TreeView. Genes shown in red are upregulated, and those shown in green are downregulated relative to mock-infected cells. (B) Expression levels of 10 host immunity-related genes, most of which were differentially expressed in Ni-CE- and CE(NiN)-infected cells. Each bar represents the fold change in expression compared to the expression level of each gene in mock-infected cells.

Article Snippet: Sequences of the primers and a TaqMan probe are shown in Table . table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 Analysis Primer or probe Sequence (5′→3′) RT Rabies RT for genome CTGCTTGTAAACCAGGCATTCCCGGATGTCTG Rabies RT for anti-genome AAACAATCAAACAGCCAGAGGTCCAGATTC SYBR green assay Human GAPDH F CCTCCTGTTCGACAGTCAGC Human GAPDH R CGCCCAATACGACCAAATC TaqMan assay Rabies TaqMan probe TGATGTGTCTCGAAAA Rabies genome F GTCTGCACATGCTGAGACTCTTG Rabies genome R ACAGCCAGAGGTCCAGATTCA Open in a separate window Sequences of the primers and TaqMan probe For validation of microarray data, total RNA was reverse transcribed into cDNAs using SuperScript III reverse transcriptase and random hexamer (TaKaRa Bio).

Techniques: Infection, Microarray, Software, Expressing

Journal: Journal of Virology

Article Title: Rabies Virus Nucleoprotein Functions To Evade Activation of the RIG-I-Mediated Antiviral Response ▿

doi: 10.1128/JVI.02220-09

Figure Lengend Snippet: Validation by real-time RT-PCR of DNA microarray results for IFN-β (A), IFN-λ1 (B), CXCL10 (C), and CCL5 (D). The assay was performed with the same total RNA used in the DNA microarray experiment. Expression levels of genes were normalized to mRNA levels of GAPDH. Each bar represents the mean (± the SD) of three independent replicates. *, Significant difference (P < 0.01); ND, no detection.

Article Snippet: Sequences of the primers and a TaqMan probe are shown in Table . table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 Analysis Primer or probe Sequence (5′→3′) RT Rabies RT for genome CTGCTTGTAAACCAGGCATTCCCGGATGTCTG Rabies RT for anti-genome AAACAATCAAACAGCCAGAGGTCCAGATTC SYBR green assay Human GAPDH F CCTCCTGTTCGACAGTCAGC Human GAPDH R CGCCCAATACGACCAAATC TaqMan assay Rabies TaqMan probe TGATGTGTCTCGAAAA Rabies genome F GTCTGCACATGCTGAGACTCTTG Rabies genome R ACAGCCAGAGGTCCAGATTCA Open in a separate window Sequences of the primers and TaqMan probe For validation of microarray data, total RNA was reverse transcribed into cDNAs using SuperScript III reverse transcriptase and random hexamer (TaKaRa Bio).

Techniques: Quantitative RT-PCR, Microarray, Expressing

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 1. CCPG1 Is an LIR Motif-Containing Interactor of Human ATG8 Orthologs (A) Schematic of CCPG1 structure (NTD, N-terminal amino acids 1–230; TM, transmembrane anchor). (B) GST or GST fusions of ATG8 orthologs (LC3B, LC3C, and GABARAP) were used in affinity precipitation (AP) of transfected myc-CCPG1 from HEK293 cells. (C) GST or GST-GABARAP (mtLDS, LIR-docking site mutant) were used in AP of transfected myc-CCPG1 NTD from HEK293 cells.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Transfection, Mutagenesis

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 2. CCPG1 Is a FIP200-Interacting Protein (A) A549 NTAP (FLAG-HA)-CCPG1 cells were immunoprecipitated for tagged CCPG1 using anti-HA antibody and immunoprecipitates subjected to LC-MS/MS and CompPASS analysis (see the STAR Methods and Table S1). Interacting proteins at a cut-off of WDN score 0.8 are shown here. (B) A549 cells stably expressing NTAP empty vector () or NTAP-CCPG1 (+) were immunoprecipitated for tagged CCPG1 with anti-FLAG beads and im- munoblotted for indicated proteins. (C) A549 cells were EBSS starved or left untreated for 1 hr, prior to lysis and endogenous immunoprecipitation of CCPG1 and subsequent immunoblotting (IgG, negative control IgG). (D) HEK293 cells were transfected with FLAG-FIP200 and indicated variants of full-length (FL) GFP-CCPG1 (DNTD, amino acids 231–757). Immunoprecipitation was performed with GFP-Trap and immunoblotting performed with indicated antibodies. (E) Recombinant FIP200 was incubated with either glutathione Sepharose beads alone, or with pre-purified GST or GST-CCPG1 NTD bound beads. Affinity precipitation (AP) followed by immunoblotting was then performed to assess direct interaction. See also Figure S1 and Table S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Immunoprecipitation, Liquid Chromatography with Mass Spectroscopy, Stable Transfection, Expressing, Plasmid Preparation, Lysis, Western Blot, Negative Control, Transfection, Recombinant, Incubation

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 3. Identification of a Linear Peptide Motif in CCPG1 for Binding to FIP200 C-Terminal Region (A) A 15-mer peptide array (peptides 1–55) was probed with recombinant FIP200. Bound FIP200 was detected by indirect immunodetection. Peptide sequences corresponding to binding regions A–C are shown below the array. (B and C) HEK293 cells were transfected with FLAG-FIP200 and indicated myc-tagged deletions or truncations of CCPG1 NTD prior to anti-myc immunopre- cipitation and immunoblotting (EV, empty vector). (D) Sequence alignment of the region from amino acids 97 to 118 of human CCPG1 against vertebrate orthologs (upper) or of regions amino acids 99–113 and 17– 31 of human CCPG1 (lower). Conserved S/T and acidic residues are blue, hydrophobic residues are red. Asterisks indicate evolutionary conservation of residues. Black boxes indicate residues identical between FIR1 and FIR2. (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Binding Assay, Peptide Microarray, Recombinant, Immunodetection, Transfection, Western Blot, Plasmid Preparation, Sequencing

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 4. CCPG1 Is Recruited into Autophagosomes from the ER (A) A549 cells were transfected with siCtrl or siCCPG1 and, at 24 hr post-transfection, either left untreated or starved for 1 hr in EBSS, then stained for endogenous CCPG1. Cells with CCPG1 foci were scored (n = 3, ± SEM, *p < 0.05, two-tailed paired sample t tests). Scale bar, 20 mm. (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Transfection, Staining, Two Tailed Test

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 5. CCPG1 Is a UPR-Inducible Gene that Remodels the ER (A) A549 cells were treated with indicated ER stressors for 16 hr (Tun, tunicamycin, 2.5 mg/mL and Thaps, thapsigargin, 0.5 mM). qRT-PCR was performed for CCPG1 (n = 3, ± SEM, *p < 0.05, one-way ANOVA followed by Tukey’s post-hoc test). (B) HeLa cells were treated with indicated ER stressors (DTT, 0.5 or 2 mM, and Tun at 1 or 2.5 mg/mL, or Thaps at 0.5 mM) for 16 hr and then immunoblotted.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Quantitative RT-PCR

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 6. Defective Proteostasis in the Pancreas of Ccpg1 Hypomorphic Mice (A and B) Whole pancreata from littermate 6-week-old WT (+/+) or Ccpg1 hypomorphic (GT/GT) mice were immunoblotted for CCPG1 or subjected to RNA extraction and qRT-PCR for Ccpg1 (n = 3 pairs, ± SEM, ***p < 0.001, two-tailed t test). (C and D) Fifty mg of whole pancreata from littermate pairs of 6-week-old WT and Ccpg1 hypomorphic mice were homogenized in SDS. Insoluble protein was pelleted, washed and extracted in 8 M urea +10 mM DTT. Pellet samples were normalized according to protein concentration in the soluble fraction and subjected to label-free LC-MS/MS quantification. A median absolute deviation analysis is presented as a heatmap here to show species changing significantly between pairs of mice (pairs joined by connecting brackets). Secretory enzymes are in red, ER luminal chaperones/oxidoreductases are in blue. (E and F) Detergent soluble and insoluble samples prepared as above were immunoblotted and ratios of insoluble to soluble protein species obtained via densitometry (n = 3 pairs, ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed t tests). See also Figure S5 and Table S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: RNA Extraction, Quantitative RT-PCR, Two Tailed Test, Protein Concentration, Liquid Chromatography with Mass Spectroscopy

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 7. Loss of Cell Polarization and ER Homeostasis, and Consequent Tissue Injury, in Ccpg1 Hypomorphic Exocrine Pancreata (A) The acinar unit of the exocrine pancreas. Polarized acinar cells secrete condensed enzyme (zymogen) granules into ducts from their apical stores. These enzymes are initially synthesized in the expansive rough ER (rER), which occupies the basolateral regions of the cell. (B) CARS imaging or immunohistochemical staining for the ER (protein disulfide isomerase, PDI) in pancreatic tissue from 6-week-old littermate WT (+/+) or Ccpg1 hypomorphic (GT/GT) mice. Punctate CARS signals indicate protein or lipid inclusions. Scale bars, 20 mm. (C) Transmission electron microscopy (TEM) of pancreata from 6-week-old littermate pairs. Scale bar, 5 mm. Analysis of percent cytosolic area occupied by osmophilic protein granules was performed in ImageJ (n = 4 pairs, ± SEM, *p < 0.05, two-tailed t test). (D) High magnification TEM of a Ccpg1 hypomorphic mouse reveals that the rER is distended and many supernumerary inclusions are in fact intracisternal granule-like structures (arrows in zoomed inset). Scale bar, 1 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Synthesized, Imaging, Immunohistochemical staining, Staining, Transmission Assay, Electron Microscopy, Two Tailed Test